Provides files and formats for handling structure data.
More...
|
class | seqan3::format_vienna |
| The Vienna format (dot bracket notation) for RNA sequences with secondary structure. More...
|
|
class | seqan3::structure_file_input< traits_type_, selected_field_ids_, valid_formats_ > |
| A class for reading structured sequence files, e.g. Stockholm, Connect, Vienna, ViennaRNA bpp matrix ... More...
|
|
struct | seqan3::structure_file_input_default_traits_aa |
| A traits type that specifies input as amino acids. More...
|
|
struct | seqan3::structure_file_input_default_traits_rna |
| The default traits for seqan3::structure_file_input. More...
|
|
interface | structure_file_input_format |
| The generic concept for structure file in formats. More...
|
|
struct | seqan3::structure_file_input_options< seq_legal_alphabet, structured_seq_combined > |
| The options type defines various option members that influence the behaviour of all or some formats. More...
|
|
interface | structure_file_input_traits |
| The requirements a traits_type for seqan3::structure_file_input must meet. More...
|
|
class | seqan3::structure_file_output< selected_field_ids_, valid_formats_ > |
| A class for writing structured sequence files, e.g. Stockholm, Connect, Vienna, ViennaRNA bpp matrix ... More...
|
|
interface | structure_file_output_format |
| The generic concept for structure file out formats. More...
|
|
struct | seqan3::structure_file_output_options |
| The options type defines various option members that influence the behaviour of all or some formats. More...
|
|
class | seqan3::structure_record< field_types, field_ids > |
| The record type of seqan3::structure_file_input. More...
|
|
Provides files and formats for handling structure data.
### Reading structure filesStructured sequence files contain intra-molecular interactions of RNA or protein. Usually, but not necessarily, they contain the nucleotide or amino acid sequences and descriptions as well. Interactions can be represented either as fixed _secondary structure_, where every character is assigned at most one interaction partner (structure of minimum free energy), or an _annotated sequence_, where every character is assigned a set of interaction partners with specific base pair probabilities.
The structured sequence file abstraction supports reading ten different fields:
- seqan3::field::seq (sequence)
- seqan3::field::id (identifier)
- seqan3::field::bpp (annotated sequence)
- seqan3::field::structure (secondary structure)
- seqan3::field::structured_seq (sequence and structure in one range)
- seqan3::field::energy (minimum free energy)
- seqan3::field::react (reactivity)
- seqan3::field::react_err (reactivity error)
- seqan3::field::comment (free text)
- seqan3::field::offset (index of first sequence character)
The first three fields are retrieved by default (and in that order). The
seqan3::field::structured_seq may be selected to have sequence and structure directly stored in a more memory-efficient combined container. If you select this field you must not select
seqan3::field::seq or
seqan3::field::structure.#### Construction and specialisationThis class comes with two constructors, one for construction from a file name and one for construction from an existing stream and a known format. The first one automatically picks the format based on the extension of the file name. The second can be used if you have a non-file stream, like
std::cin or
std::istringstream, that you want to read from and/or if you cannot use file-extension based detection, but know that your input file has a certain format.
In most cases the template parameters are deduced completely automatically, e.g. reading from a
std::istringstream:
#include <filesystem>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
UUGGAGUACACAACCUGUACACUCUUUC
..(((((..(((...)))..)))))... (-3.71))";
int main()
{
{
fout.
emplace_back(
"GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA"_rna4,
"S.cerevisiae_tRNA-PHE M10740/1-73",
"(((((((..((((........)))).((((.........)))).....(((((.......))))))))))))."_wuss51);
fout.emplace_back("UUGGAGUACACAACCUGUACACUCUUUC"_rna4, "example", "..(((((..(((...)))..)))))..."_wuss51);
}
}
A class for writing structured sequence files, e.g. Stockholm, Connect, Vienna, ViennaRNA bpp matrix ...
Definition: io/structure_file/output.hpp:63
void emplace_back(arg_t &&arg, arg_types &&... args)
Write a record to the file by passing individual fields.
Definition: io/structure_file/output.hpp:364
Provides seqan3::structure_file_output and corresponding traits classes.
The SeqAn namespace for literals.
Provides seqan3::rna4, container aliases and string literals.
T temp_directory_path(T... args)
Provides the WUSS format for RNA structure.
Note that this is not the same as writing `structure_file_input<>` (with angle brackets). In the latter case they are explicitly set to their default values, in the former case [automatic deduction](
https://en.cppreference.com/w/cpp/language/class_template_argument_deduction) happens which chooses different parameters depending on the constructor arguments. For opening from file, `structure_file_input<>` would have also worked, but for opening from stream it would not have.
In some cases, you do need to specify the arguments, e.g. if you want to read amino acids:
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
UUGGAGUACACAACCUGUACACUCUUUC
..(((((..(((...)))..)))))... (-3.71))";
int main()
{
}
You can define your own traits type to further customise the types used by and returned by this class, see seqan3::structure_file_default_traits_rna for more details. As mentioned above, specifying at least one template parameter yourself means that you loose automatic deduction so if you want to read amino acids **and** want to read from a string stream you need to give all types yourself:
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
ACEWACEW
HGEBHHHH
> example
ACEWACEWACEWACEW
HGEBHHHHHGEBHHHH)";
int main()
{
}
A class template that holds a choice of seqan3::field.
Definition: record.hpp:128
Type that contains multiple types.
Definition: type_list.hpp:29
Provides seqan3::type_list.
#### Reading record-wiseYou can iterate over this file record-wise:
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
ACEWACEW
HGEBHHHH
> example
ACEWACEWACEWACEW
HGEBHHHHHGEBHHHH)";
int main()
{
using structure_file_input_t =
for (auto & rec : fin)
{
}
}
Provides seqan3::debug_stream and related types.
auto const to_char
A view that calls seqan3::to_char() on each element in the input range.
Definition: to_char.hpp:63
debug_stream_type debug_stream
A global instance of seqan3::debug_stream_type.
Definition: debug_stream.hpp:37
Provides seqan3::views::to_char.
In the above example, rec has the type
seqan3::structure_file_input::record_type which is a specialisation of
seqan3::record and behaves like a
std::tuple (that's why we can access it via get). Instead of using the
seqan3::field based interface on the record, you could also use `std
get<0>` or even `std
get<rna4_vector>` to retrieve the sequence, but it is not recommended, because it is more error-prone.
*Note:* It is important to write `auto &` and not just `auto`, otherwise you will copy the record on every iteration. Since the buffer gets "refilled" on every iteration, you can also move the data out of the record if you want to store it somewhere without copying:
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
UUGGAGUACACAACCUGUACACUCUUUC
..(((((..(((...)))..)))))... (-3.71))";
int main()
{
using record_type = typename decltype(fin)::record_type;
for (auto & rec : fin)
}
#### Reading record-wise (decomposed records)Instead of using `get` on the record, you can also use [structured bindings](
https://en.cppreference.com/w/cpp/language/structured_binding) to decompose the record into its elements:
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
ACEWACEW
HGEBHHHH
> example
ACEWACEWACEWACEW
HGEBHHHHHGEBHHHH)";
int main()
{
using structure_file_input_t =
for (auto & [seq, id, structure] : fin)
{
}
}
@ structure
Fixed interactions, usually a string of structure alphabet characters.
@ seq
The "sequence", usually a range of nucleotides or amino acids.
constexpr auto const & get(configuration< configs_t... > const &config) noexcept
This is an overloaded member function, provided for convenience. It differs from the above function o...
Definition: configuration.hpp:415
In this case you immediately get the three elements of the tuple: `seq` of
seqan3::structure_file_input::seq_type, `id` of
seqan3::structure_file_input::id_type and `structure` of
seqan3::structure_file_input::structure_type. **But beware: with structured bindings you do need to get the order of elements correctly!**#### Reading record-wise (custom fields)If you want to skip specific fields from the record you can pass a non-empty fields trait object to the structure_file_input constructor to select the fields that should be read from the input. For example to choose a combined field for SEQ and STRUCTURE (see above). Or to never actually read the STRUCTURE, if you don't need it. The following snippets demonstrate the usage of such a fields trait object.
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
UUGGAGUACACAACCUGUACACUCUUUC
..(((((..(((...)))..)))))... (-3.71))";
int main()
{
for (auto & [id, struc_seq] : fin)
{
<< '\n';
}
}
Provides seqan3::views::elements.
When reading a file, all fields not present in the file (but requested implicitly or via the `selected_field_ids` parameter) are ignored.#### Views on filesSince SeqAn files are ranges, you can also create views over files. A useful example is to filter the records based on certain criteria, e.g. minimum length of the sequence field:
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
UUGGAGUACACAACCUGUACACUCUUUC
..(((((..(((...)))..)))))... (-3.71))";
int main()
{
auto minimum_length5_filter = std::views::filter(
[](auto const & rec)
{
});
for (auto & rec : fin | minimum_length5_filter)
}
constexpr size_t size
The size of a type pack.
Definition: type_pack/traits.hpp:146
The <ranges> header from C++20's standard library.
#### End of fileYou can check whether a file is at end by comparing begin() and end() (if they are the same, the file is at end).#### FormatsCurrently, the only implemented format is
seqan3::format_vienna. More formats will follow soon.
### Writing structure filesStructured sequence files contain intra-molecular interactions of RNA or protein. Usually, but not necessarily, they contain the nucleotide or amino acid sequences and descriptions as well. Interactions can be represented either as fixed _secondary structure_, where every character is assigned at most one interaction partner (structure of minimum free energy), or an _annotated sequence_, where every character is assigned a set of interaction partners with specific base pair probabilities.
The structured sequence file abstraction supports writing ten different fields:
- seqan3::field::seq (sequence)
- seqan3::field::id (identifier)
- seqan3::field::bpp (annotated sequence)
- seqan3::field::structure (secondary structure)
- seqan3::field::structured_seq (sequence and structure in one range)
- seqan3::field::energy (minimum free energy)
- seqan3::field::react (reactivity)
- seqan3::field::react_err (reactivity error)
- seqan3::field::comment (free text)
- seqan3::field::offset (index of first sequence character)
The member functions take any and either of these fields. If the field ID of an argument cannot be deduced, it is assumed to correspond to the field ID of the respective template parameter.#### Construction and specialisationThis class comes with two constructors, one for construction from a file name and one for construction from an existing stream and a known format. The first one automatically picks the format based on the extension of the file name. The second can be used if you have a non-file stream, like
std::cout or
std::ostringstream, that you want to read from and/or if you cannot use file-extension based detection, but know that your output file has a certain format.
In most cases the template parameters are deduced completely automatically:
#include <filesystem>
int main()
{
}
Writing to
std::cout:
int main()
{
fout.emplace_back("AACGUU"_rna4, "example_id", ".(())."_wuss51);
}
Note that this is not the same as writing `structure_file_output<>` (with angle brackets). In the latter case they are explicitly set to their default values, in the former case [automatic deduction](
https://en.cppreference.com/w/cpp/language/class_template_argument_deduction) happens which chooses different parameters depending on the constructor arguments. Prefer deduction over explicit defaults.#### Writing record-wiseYou can iterate over this file record-wise:
int main()
{
for (int i = 0; i < 10; i++)
{
seqan3::rna5_vector
seq{
"ACGU"_rna5};
fout.emplace_back(seq, id, structure);
fout.push_back(
std::tie(seq,
id, structure));
}
}
Provides seqan3::rna5, container aliases and string literals.
The easiest way to write to a sequence file is to use the push_back() or emplace_back() member functions. These work similarly to how they work on a
std::vector. If you pass a tuple to push_back() or give arguments to emplace_back() the
seqan3::field ID of the i-th tuple-element/argument is assumed to be the i-th value of selected_field_ids, i.e. by default the first is assumed to be
seqan3::field::seq, the second
seqan3::field::id and the third one
seqan3::field::structure. You may give less fields than are selected, if the actual format you are writing to can cope with less (e.g. for Vienna it is sufficient to write
seqan3::field::seq,
seqan3::field::id and
seqan3::field::structure, even if selected_field_ids also contains
seqan3::field::energy).
You may also use the output file's iterator for writing, however, this rarely provides an advantage.#### Writing record-wise (custom fields)If you want to pass a combined object for SEQ and STRUCTURE fields to push_back() / emplace_back(), or if you want to change the order of the parameters, you can pass a non-empty fields trait object to the structure_file_output constructor to select the fields that are used for interpreting the arguments.
The following snippets demonstrates the usage of such a fields trait object.
int main()
{
for (int i = 0; i < 10; i++)
{
fout.push_back(
std::tie(
id, structured_sequence));
}
}
A seqan3::alphabet_tuple_base that joins a nucleotide alphabet with an RNA structure alphabet.
Definition: structured_rna.hpp:56
T emplace_back(T... args)
Provides the composite of nucleotide with structure alphabets.
A different way of passing custom fields to the file is to pass a
seqan3::record – instead of a tuple – to push_back(). The
seqan3::record clearly indicates which of its elements has which
seqan3::field ID so the file will use that information instead of the template argument. This is especially handy when reading from one file and writing to another, because you don't have to configure the output file to match the input file, it will just work:
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
UUGGAGUACACAACCUGUACACUCUUUC
..(((((..(((...)))..)))))... (-3.71))";
int main()
{
bool criteria = true;
for (auto & r : fin)
{
if (criteria)
fout.push_back(r);
}
}
#### Writing record-wise in batchesYou can write multiple records at once, by assigning to the file:
int main()
{
{"ACGT"_rna5, "First", "...."_wuss51},
{"NATA"_rna5, "2nd", "...."_wuss51},
{"GATA"_rna5, "Third", "...."_wuss51}};
fout = range;
}
#### File I/O pipelinesRecord-wise writing in batches also works for writing from input files directly to output files, because input files are also input ranges in SeqAn. This can be combined with file-based views to create I/O pipelines:
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
UUGGAGUACACAACCUGUACACUCUUUC
..(((((..(((...)))..)))))... (-3.71))";
int main()
{
}
#### Column-based writingThe record-based interface treats the file as a range of tuples (the records), but in certain situations you might have the data as columns, i.e. a tuple-of-ranges, instead of range-of-tuples.
You can use column-based writing in that case, it uses operator=() and
seqan3::views::zip():
struct data_storage_t
{
};
int main()
{
data_storage_t data_storage{};
fout =
seqan3::views::zip(data_storage.sequences, data_storage.ids, data_storage.structures);
}
Container that stores sequences concatenated internally.
Definition: concatenated_sequences.hpp:89
Provides seqan3::concatenated_sequences.
constexpr auto zip
A view adaptor that takes several views and returns tuple-like values from every i-th element of each...
Definition: zip.hpp:573
Provides seqan3::views::zip.
#### FormatsCurrently, the only implemented format is
seqan3::format_vienna. More formats will follow soon.